I will pay for the following article DNA Barcoding Invertebrate #1. The work is to be 2 pages with three to five sources, with in-text citations and a reference page. Biology Topic: lab report on DNA barcoding Introduction: DNA barcoding provides a versatile tool for ification of organism based on DNA taxonomy and delimitation and ‘discovery’ of new species. Sequences that are used as barcodes are usually those that are unique and conserved within a species. In DNA barcoding, usually a four staged approache is engaged. The first stage is to obtain a specimen which may be from from tissue or culture collections. In the second stage, laboratory analysis which involves extraction of genetic material to obtain DNA batcode sequence is done. These sequences are later placed in a barcode database such as the Barcode intiative to be used as species identifiers to assign unknown specimens to known species. Currently two such databases exists, the Barcode of life (BOLD) and The International Nucleotide Sequence Database Collaborative which is an intiative of the three main Nucleotide databases, GenBank, EMBL and DDBJ. The fouth and final stage is to carry out an analysis where specimens are identified with the closest matching reference record in the aforementioned databases.
In this lab report, we sought to perform a barcode analysis using mayfly DNA sequences in the BOLD database. The barcode sequence is mainly a short DNA sequence which has a uniform location in the genome and is used to identify species. One of the commonly used sequence in DNA barcoding is the cytochrome oxidase subunit 1 (COI). This was the sequence we used this work. The barcoding process involves identifying a universal locus which has retained enough sequence conservation throughout evolution and can be sourced from many organisms. This sequence should also be diverse so as to be competent enough to differentiate a target species to the family level. Generally regions of the chloroplast (rbcL gene) and the mitochondria (COI) meet these requirements. Various studies have been undertaken by Herbert et al (2003a, 2004b) and established this COI sequence as the sequence of choice in DNA barcoding in insects and vertebrates. Inverterbrates such as mayfly are collected whole and may be euthanized in a kill jar by placing them in a freezer. In the lab, primers are designed to target the conserved regions flanking the rbcL or the COI regions.
Examples of the barcoding primers which may be used in insects
5-GTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG-3 (forward primer – LepF1_t1)
5-TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG-3 (forward primer – VF1_t1)
5-TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG-3 (forward primer – VF1d_t1)
5-TGTAAAACGACGGCCAGTTCTCAACCAACCAIAAIGAIATIGG-3 (forward primer – VF1i_t1)
5-CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA-3 (reverse primer – LepR1_t1)
5-CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA-3 (reverse primer – VR1d_t1)
5-CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA-3 (reverse primer – VR1_t1)
5-CAGGAAACAGCTATGACTAGACTTCTGGGTGICCIAAIAAICA-3 (reverse primer – VR1i_t1)
These primers should be able to accommodate degeneracy occurring in the conserved regions as a result of evolutionary processes such as the ‘genetic drift’.
Results:
BLAST results:FASTA format for the top 2 matches
Sequence JF287131.1:
>.gi|325653673|gb|JF287131.1| Ephemerella subvaria voucher 08-SWRC-0922 cytochrome oxidase subunit 1 (COI) gene, partial cds. mitochondrial
ACTTTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTGGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGGTTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGAGCTGTGAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT
Sequence two JF287129.1.
>.gi|325653669|gb|JF287129.1| Ephemerella subvaria voucher 08-SWRC-0728 cytochrome oxidase subunit 1 (COI) gene, partial cds. mitochondrial
ACTCTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTAGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGATTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGGGCTGTAAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT
The top two matches in the BLAST database
Accession numbersequences name E valuequery coverage
1. JF287129.1Ephemerella subvaria 0.0 100%
voucher 08-SWRC-0728
cytochrome oxidase
subunit 1 (COI) gene,
partial cds. mitochondrial
2. JF287129.1Ephemerella subvaria
voucher 08-SWRC-0728 0.0 100%
cytochrome oxidase
subunit 1 (COI) gene,
partial cds. mitochondrial
The top two mathces in the BOLD database
Table 1: the first two results of the species level match made by sample #3 in the BOLD database
Phylum
class
order
Family
Genus
Species
Specimen similarity (%)
Arthropoda
Insecta
ephemeroptera
Ephemerellidae
Ephemerella
Subvaria
100
Arthropoda
Insecta
ephemeroptera
Ephemerellidae
Ephemerella
Subvaria
100
Discussion:
Insects are diverse in nature and present an interesting opportunity for a host of target groups such as taxonomist, conservationists and ecologists. The coming into place of the DNA technology and its bulging potential has revolutionarized the classification of organisms from the morphological perspective to a more advanced DNA taxonomy which requires DNA barcoding. It provides a novel sytem structured to provide a rapid and accurate species identification by use of short, standardized gene regions as species tag. Mayfly are a common feature in undisturbed freshwater bodies and are utilized by biomonitoring teams in establishing the water quality (Bauernfeind and Moog, 2000).
A match in the taxonomic ID and BOLD ID as evidenced by the BOLD and BLAST results. In some cases matches may fail to occur particularly when the sample is contaminated with DNA from other sources. These contaminants ultimately distort the outcome of the BLAST resulting yielding misleading results. False positives may also occur in queries done in the BOLD database where closely allied congeneric species which have not yet been established in the identification tree may appear in the results thereby resulting to a misleading clasification of the organism of interest.
References
Bauernfeind, E. and Moog, O. (2000). Mayflies (Insecta: Ephemeroptera) and the assessment
of ecological integrity : a methodological approach. Hydrobiologia 422:71-83
Hebert, P. D. N., A. Cywinska, S. L. Ball, and J. R. Dewaard. (2003a). Biological identifications
through DNA bar codes. Proceedings of the Royal Society of London B Biological Sciences 270: 313–321.
Hebert P.D.N., Stoeckle M.Y, Zemlak T.S., Francis C.M. (2004b). Identification of Birds
through DNA Barcodes. PLoS Biol 2: e312.
Elitewriterhelp.com is an online academic writing site that provides a variety of services to students and professionals in need of essay, dissertation, and research paper assistance. This website was founded by experienced writers and editors who understand the needs of today’s student community. With their help, students can get a well-written paper without having to worry about the quality or accuracy of their content.
Elitewriterhelp.com offers a wide range of services that are designed to meet the needs of any student or professional looking for some extra help with their academic work. From simple editing services to complete custom writing pieces, they have something for everyone! Their team consists of highly qualified writers and editors who have years of experience in both academia and industry sectors across all fields such as English literature, nursing sciences, medical science, engineering design & technology, accounting & finance etc., making them one of the best providers around when it comes to providing quality content writing services.
When it comes to their custom writing service, Elitewriterhelp.com provides everything from essays & dissertations to research papers & lab reports; all written according to your exact specifications & requirements so that you can be sure your professor will be impressed with what you submit! They also provide formatting help which includes APA/MLA/Chicago style formatting for those stuck on tedious details like citations or bibliography entries; perfect for those last-minute assignments!
For those looking for proofreading & editing services instead; Elitewriterhelp.com has you covered too! The team at this website offer professional copyediting which can check grammar errors and spellings mistakes while still preserving your original voice within the text; ensuring that whatever piece you submit looks great while still sounding exactly how you want it do sound! What’s more is if required they can also provide advice on how best to improve certain parts in order make sure your work meets the criteria set by your professors so no marks are lost due to minor mistakes made in hurry or ignorance.
Last but not least is Elitewriterhelp’s paraphrasing service which helps take care off any plagiarism risks associated with submission an assignment where quotes are used extensively taken from sources outside class materials (eBooks etc.). The team will ensure that anything being submitted sounds fresh while leaving out any potential legal issues plaguing people using other authors works without proper permission given first when appropriate credit isn’t given otherwise – definitely something worth investing into before submitting examples cited within studies found elsewhere apart from class material sources only mentioned once during seminars etc..
To sum up: Elitewriterhelp offers students access top-notch custom writing pieces as well as editing/proofreading packages for existing ones already written – perfect for double checking against silly grammatical errors / typos overlooked during initial composition stages meaning there’s always hope even when running short on time ahead up coming deadlines looming near after long lectures spent inside classrooms sat away from laptops used mainly taking notes by hand easily misplaceable later down line afterwards rendering past efforts worthless sadly…
Why Work with Us
Top Quality and Well-Researched Papers
We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.
Professional and Experienced Academic Writers
We have a team of professional writers with experience in academic and business writing. Many are native speakers and able to perform any task for which you need help.
Free Unlimited Revisions
If you think we missed something, send your order for a free revision. You have 10 days to submit the order for review after you have received the final document. You can do this yourself after logging into your personal account or by contacting our support.
Prompt Delivery and 100% Money-Back-Guarantee
All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.
Original & Confidential
We use several writing tools checks to ensure that all documents you receive are free from plagiarism. Our editors carefully review all quotations in the text. We also promise maximum confidentiality in all of our services.
24/7 Customer Support
Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.
Try it now!
How it works?
Follow these simple steps to get your paper done
Place your order
Fill in the order form and provide all details of your assignment.
Proceed with the payment
Choose the payment system that suits you most.
Receive the final file
Once your paper is ready, we will email it to you.
Our Services
No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.
Essays
No matter what kind of academic paper you need and how urgent you need it, you are welcome to choose your academic level and the type of your paper at an affordable price. We take care of all your paper needs and give a 24/7 customer care support system.
Admissions
Admission Essays & Business Writing Help
An admission essay is an essay or other written statement by a candidate, often a potential student enrolling in a college, university, or graduate school. You can be rest assurred that through our service we will write the best admission essay for you.
Reviews
Editing Support
Our academic writers and editors make the necessary changes to your paper so that it is polished. We also format your document by correctly quoting the sources and creating reference lists in the formats APA, Harvard, MLA, Chicago / Turabian.
Reviews
Revision Support
If you think your paper could be improved, you can request a review. In this case, your paper will be checked by the writer or assigned to an editor. You can use this option as many times as you see fit. This is free because we want you to be completely satisfied with the service offered.