You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will iden
You are assigned two unknown bacteria. One is Amy’s Unknown that you will identify according to the simplified Bergey’s procedure (‘ID Notes’ in Canvas) and the other is DB Unknown that you will identify according to the simplified DNA Barcoding steps below.
These two bacteria may or may not be the same, not intentionally assigned one way or the other. You will submit your completed report as the TEXT in email by ‘Reply’ to the ‘Unknown Bacteria” email. Attachment is NOT acceptable.
Part 1 Bergey’s
Amy’s lab note for Unknown 47 test results is copied below.
Use the tests discussed in BIO 150 Lab and the ‘ID Notes’ to identify Amy’s unknown.
Complete the ID Report below. Your ID Report should include interpretation of the observations described in Amy’s note; that is, you need to state the meaning of the results in microbiology terms.
Amy’s Unknown 47
Gram staining: appeared pink, rod shape
Colony diameter: about 1-2 mm
FTM: growth throughout
Durham glucose: yellow, bubble in the inverted glass vial
Durham lactose: yellow, bubble in the inverted glass vial
Kligler’s: entire tube turned yellow, yellow butt, yellow slant, medium cracked up, no black color
MSA: red, no growth
Semisolid stab: molds! tube appeared milky?
Gelatin stab: green mold on top of medium, gross!
Citrate test: green
Urease test: no color change
Catalase: bubbles
Endospore staining: red rods
Acid-fast staining: blue rods
Part 2 DNA Barcoding
Follow the following steps to identify your DB unknown.
The sequence of your DB unknown is copied below.
Type pubmed.gov into browser
Click on NCBI, National Center for Biotechnology Information (upper left corner)
Click on BLAST (right hand side, under ‘Popular Resources’)
Click on Nucleotide BLAST (nucleotide > nucleotide)
The page opens up is ‘Standard Nucleotide BLAST’
Enter your sequence to the box ‘Enter Query Sequence’
Leave everything as default (that is, do not change setting)
Scroll down
Click on ‘BLAST’ button on the lower left
Wait for a few seconds
Scroll down to review the results
Answer questions in the ID Report below.
DB#5
AGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAG
CAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGA
TAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTT
GCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAG
CTGGTCTGAGAGGATGACCAGCAACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTG
GGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCNGCGTGTATGAAGAAGGCCTTCGGGTTGT
AAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAA
GCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGC
GTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTG
ATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCT
ID Report
Your Name –
Part 1 Bergey’s
Amy’s Unknown Number – _____; Identification –
A. Interpret all of Amy’s Unknown test results listed in Part I above:
B. Stepwise Reasoning: (state your rationale; describe how you identified the unknown, based on what; how the other possibilities are ruled out, etc. It is very important to systemically eliminate the other possibilities, step by step, dichotomous manner.)
C. One paragraph describing the disease(s) this unknown bacterium may cause:
D. Reference citation: (cite the sources of information)
Part 2 DNA Barcoding
Unknown DB Number – _____; Identification –
1. What is the name this unknown bacterium according to the NCBI BLAST sequence analysis?
2. Can the bacterium of the unknown DB# _____ possibly be the same bacterium as Amy’s unknown # _____?
3. Name two test results (any two among the ones discussed in our BIO 150 Lab) that can support your answer to (1). Name another two test results that can support your answer to (2).
Elitewriterhelp.com is an online academic writing site that provides a variety of services to students and professionals in need of essay, dissertation, and research paper assistance. This website was founded by experienced writers and editors who understand the needs of today’s student community. With their help, students can get a well-written paper without having to worry about the quality or accuracy of their content.
Elitewriterhelp.com offers a wide range of services that are designed to meet the needs of any student or professional looking for some extra help with their academic work. From simple editing services to complete custom writing pieces, they have something for everyone! Their team consists of highly qualified writers and editors who have years of experience in both academia and industry sectors across all fields such as English literature, nursing sciences, medical science, engineering design & technology, accounting & finance etc., making them one of the best providers around when it comes to providing quality content writing services.
When it comes to their custom writing service, Elitewriterhelp.com provides everything from essays & dissertations to research papers & lab reports; all written according to your exact specifications & requirements so that you can be sure your professor will be impressed with what you submit! They also provide formatting help which includes APA/MLA/Chicago style formatting for those stuck on tedious details like citations or bibliography entries; perfect for those last-minute assignments!
For those looking for proofreading & editing services instead; Elitewriterhelp.com has you covered too! The team at this website offer professional copyediting which can check grammar errors and spellings mistakes while still preserving your original voice within the text; ensuring that whatever piece you submit looks great while still sounding exactly how you want it do sound! What’s more is if required they can also provide advice on how best to improve certain parts in order make sure your work meets the criteria set by your professors so no marks are lost due to minor mistakes made in hurry or ignorance.
Last but not least is Elitewriterhelp’s paraphrasing service which helps take care off any plagiarism risks associated with submission an assignment where quotes are used extensively taken from sources outside class materials (eBooks etc.). The team will ensure that anything being submitted sounds fresh while leaving out any potential legal issues plaguing people using other authors works without proper permission given first when appropriate credit isn’t given otherwise – definitely something worth investing into before submitting examples cited within studies found elsewhere apart from class material sources only mentioned once during seminars etc..
To sum up: Elitewriterhelp offers students access top-notch custom writing pieces as well as editing/proofreading packages for existing ones already written – perfect for double checking against silly grammatical errors / typos overlooked during initial composition stages meaning there’s always hope even when running short on time ahead up coming deadlines looming near after long lectures spent inside classrooms sat away from laptops used mainly taking notes by hand easily misplaceable later down line afterwards rendering past efforts worthless sadly…
